Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBM4607
(Plasmid #18795)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18795 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOBD2
  • Backbone size w/o insert (bp) 7167
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sir4
  • Alt name
    STE9
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    891
  • Mutation
    aa 951-1200
  • GenBank ID
    M37249
  • Entrez Gene
    SIR4 (a.k.a. YDR227W, ASD1, STE9, UTH2)
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CACAATATTTCAAGCTATACC
  • 3′ sequencing primer CTCATCAACCAACGAAACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBM4607 was a gift from Mark Johnston (Addgene plasmid # 18795 ; http://n2t.net/addgene:18795 ; RRID:Addgene_18795)
  • For your References section:

    'Calling Cards' method for high-throughput identification of targets of yeast DNA-binding proteins. Wang H, Heinz ME, Crosby SD, Johnston M, Mitra RD. Nat Protoc. 2008;3(10):1569-77. doi: 10.1038/nprot.2008.148. 10.1038/nprot.2008.148 PubMed 18802438