Skip to main content
Addgene

pnxABE-flgn
(Plasmid #187932)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187932 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    colE1
  • Total vector size (bp) 10279
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ecTadA(8e)-nxCas9 (D10A)
  • gRNA/shRNA sequence
    flgn
  • Species
    P. chengduensis DY56–96

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tctcgtttggattgcaactggtc
  • 3′ sequencing primer ttggccagggtcagggc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pnxABE-flgn was a gift from Yi Xiao (Addgene plasmid # 187932 ; http://n2t.net/addgene:187932 ; RRID:Addgene_187932)

  • For your References section:

    Adenine Base Editing System for Pseudomonas and Prediction Workflow for Protein Dysfunction via ABE. Abdullah, Wang P, Han T, Liu W, Ren W, Wu Y, Xiao Y. ACS Synth Biol. 2022 Apr 15;11(4):1650-1657. doi: 10.1021/acssynbio.2c00066. Epub 2022 Apr 7. 10.1021/acssynbio.2c00066 PubMed 35389616
Related items:
Commonly requested with: