pHH21-BNA-Luc
(Plasmid
#187924)
-
PurposeExpresses Luciferase reporter RNA construct under the 5' and 3' UTRs of NA segment of Influenza B/Brisbane/60/2008 virus by RNA polymerase I in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHH21
- Backbone size w/o insert (bp) 2828
- Total vector size (bp) 4637
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsStreak an ampicillin agar plate from the frozen glycerol stock. Grow bacterial culture from a single colony grown on the plate.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReporter RNA (RNA encoding firefly luciferase under the viral promoter of segment 6 of Influenza B/Brisbane/60/2008 virus)
-
Alt nameB-NA-Luc
-
Insert Size (bp)1809
- Promoter RNA polymease I Promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAACGCTGGGCGTTAATCAAAGAGGCG
- 3′ sequencing primer GGGGGACACTTTCGGACATCTGGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHH21-BNA-Luc was a gift from Arindam Mondal (Addgene plasmid # 187924 ; http://n2t.net/addgene:187924 ; RRID:Addgene_187924) -
For your References section:
A Comprehensive Roadmap Towards the Generation of an Influenza B Reporter Assay Using a Single DNA Polymerase-Based Cloning of the Reporter RNA Construct. Kedia N, Banerjee S, Mondal A. Front Microbiol. 2022 May 25;13:868367. doi: 10.3389/fmicb.2022.868367. eCollection 2022. 10.3389/fmicb.2022.868367 PubMed 35694292