Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSAC212
(Plasmid #187912)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187912 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS416
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ade2 KO CRISPEY cassette
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GCAGGTCGGAAATATTTATGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSAC212 was a gift from Hunter Fraser (Addgene plasmid # 187912 ; http://n2t.net/addgene:187912 ; RRID:Addgene_187912)
  • For your References section:

    Gene-by-environment interactions are pervasive among natural genetic variants. Chen SA, Kern AF, Ang RML, Xie Y, Fraser HB. Cell Genom. 2023 Feb 28;3(4):100273. doi: 10.1016/j.xgen.2023.100273. eCollection 2023 Apr 12. 10.1016/j.xgen.2023.100273 PubMed 37082145