Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCJR01
(Plasmid #187888)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187888 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBC SK+
  • Backbone manufacturer
    Stratagene (Agilent Tech)
  • Backbone size w/o insert (bp) 3334
  • Total vector size (bp) 5338
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNA insert has homology to a rRNA region of the Campylobacter jejuni chromosome with an added central NotI restriction site
  • Species
    Campylobacter jejuni strain CDC9511
  • Insert Size (bp)
    2004
  • Promoter none

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgggccccccctcgacgcgtaggcggattatcaagtc
  • 3′ sequencing primer accgcggtggcggcctcgccgctactgacgcaatctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCJR01 was a gift from Gaylen Uhlich (Addgene plasmid # 187888 ; http://n2t.net/addgene:187888 ; RRID:Addgene_187888)
  • For your References section:

    Cloning vectors for gene delivery, integration and expression in Campylobacter jejuni. Uhlich GA, Bagi L, Gunther NW 4th. Biotechniques. 2022 Apr 13. doi: 10.2144/btn-2021-0096. 10.2144/btn-2021-0096 PubMed 35416085