Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKL2315
(Plasmid #187876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187876 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTF505
  • Backbone manufacturer
    Keunsub Lee
  • Backbone size w/o insert (bp) 6149
  • Total vector size (bp) 9194
  • Modifications to backbone
    Cre recombinase and sacB expression cassettes were cloned.
  • Vector type
    Bacterial Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Insert Size (bp)
    1032
  • GenBank ID
    MF405193.1
  • Promoter J23107

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAACACATGAGCGAAACCCT
  • 3′ sequencing primer CTATAGCAGCGGAGGGGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a R139S mutation in Cre recombinase. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL2315 was a gift from Kan Wang (Addgene plasmid # 187876 ; http://n2t.net/addgene:187876 ; RRID:Addgene_187876)
  • For your References section:

    CRISPR RNA-guided integrase enables high-efficiency targeted genome engineering in Agrobacterium tumefaciens. Aliu E, Lee K, Wang K. Plant Biotechnol J. 2022 Jun 11. doi: 10.1111/pbi.13872. 10.1111/pbi.13872 PubMed 35690588