pEA183
(Plasmid
#187873)
-
PurposeExpresses eGFP under the virB promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEA106
-
Backbone manufacturerEphraim Aliu
- Backbone size w/o insert (bp) 6494
- Total vector size (bp) 7219
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Alt nameenhanced GFP
-
Insert Size (bp)717
-
GenBank IDMN832871.1
- Promoter Agrobacterium virB promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cgaattgtattgattggtgagct
- 3′ sequencing primer ctatagcagcggaggggttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEA183 was a gift from Kan Wang (Addgene plasmid # 187873 ; http://n2t.net/addgene:187873 ; RRID:Addgene_187873) -
For your References section:
CRISPR RNA-guided integrase enables high-efficiency targeted genome engineering in Agrobacterium tumefaciens. Aliu E, Lee K, Wang K. Plant Biotechnol J. 2022 Jun 11. doi: 10.1111/pbi.13872. 10.1111/pbi.13872 PubMed 35690588