Skip to main content
Addgene

pETDuet-1_6xHis-TEV-mCh-NDP52
(Plasmid #187829)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187829 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET Duet1
  • Backbone manufacturer
    Sigma-Aldrich
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 7496
  • Modifications to backbone
    Insertion of 6His-TEV-mCH-NDP52
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NDP52
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2142
  • GenBank ID
    10241 NM_005831
  • Entrez Gene
    CALCOCO2 (a.k.a. NDP52)
  • Tags / Fusion Proteins
    • mCherry (N terminal on insert)
    • TEV (N terminal on insert)
    • 6xHisTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACCATCGTGGAACAGTACG
  • 3′ sequencing primer gattatgcggccgtgtac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Manufactured during the Master's thesis of Daniel Bernklau

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETDuet-1_6xHis-TEV-mCh-NDP52 was a gift from Sascha Martens (Addgene plasmid # 187829 ; http://n2t.net/addgene:187829 ; RRID:Addgene_187829)
  • For your References section:

    Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627