pET-His6MBP-A3A-Gly6His6
(Plasmid #187822)

• Purpose: Expression human APOBEC3A in E.coli.
• Depositing Lab: Hao Wu
• Publication: Quantitative single cell 5hmC sequencing reveals non-canonical gene regulation by non-CG hydroxymethylation (unpublished)

Backbone

• Vector backbone: pET His6 MBP prescission LIC cloning vector (HMPKS, Addgene Plasmid #29721)
• Backbone size w/o insert (bp): 8106
• Total vector size (bp): 7108
• Modifications to backbone: The gBlock Gene Fragment, including a full-length CDS of codon-optimized human APOBEC3A (A3A) with PreScission protease cleavage sequences on both sides, was inserted between the SspI and XhoI cleavage sites.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: The A3A protein may cause mutation of this vector. Please culture individual clones and sequence them after bacterial transformation.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: APOBEC3A
• Species: H. sapiens (human)
• Insert Size (bp): 597
• Mutation: none
• GenBank ID: NM_145699
• Entrez Gene: APOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
• Promoter: T7 promoter (on the backbone)
• Tag / Fusion Protein:
  • His6 and MBP

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATGAAGCCCTGAAAGACGCGCAG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry