Skip to main content
Addgene

pHis-TEV-Nsp15
(Plasmid #187656)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187656 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET-11b
  • Backbone manufacturer
    purchased from GenScript
  • Backbone size w/o insert (bp) 5644
  • Total vector size (bp) 6760
  • Modifications to backbone
    None. GenScript cloned the expression-optimized insert into NdeI and BamHI sites of pET-11b.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Nsp15
  • Alt name
    NendoU
  • Alt name
    non-structural protein 15
  • Alt name
    uridylate-specific endoribonuclease
  • Species
    Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    1037
  • Mutation
    none
  • Entrez Gene
    N (a.k.a. GU280_gp10)
  • Promoter T7lac
  • Tag / Fusion Protein
    • TEV protease cleavable His6-tag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7, TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7 term, GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Purchased from GenScript the expression-optimized insert in the pET-11b backbone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence is MHHHHHHSSGVDLGTENLYFQSNAM + Nsp15 (amino acid residues 6453-6798 of YP_009724389).
Used for the determination of the atomic-resolution (2.6 angstrom) structure of the room temperature form of SARS-CoV-2 NendoU by serial femtosecond crystallography at an X-ray free-electron laser (XFEL), Protein Data Bank accession number 7K9P, Jernigan et al 2023 Structure 31:1-14, https://doi.org/10.1016/j.str.2022.12.009, PMID 36630960.
Confers ampicillin-resistance.
Backbone vector is pET-11b from GenScript.
Construct design by Debra T. Hansen.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHis-TEV-Nsp15 was a gift from Debra Hansen (Addgene plasmid # 187656 ; http://n2t.net/addgene:187656 ; RRID:Addgene_187656)

  • For your References section:

    Room-temperature structural studies of SARS-CoV-2 protein NendoU with an X-ray free-electron laser. Jernigan RJ, Logeswaran D, Doppler D, Nagaratnam N, Sonker M, Yang JH, Ketawala G, Martin-Garcia JM, Shelby ML, Grant TD, Mariani V, Tolstikova A, Sheikh MZ, Yung MC, Coleman MA, Zaare S, Kaschner EK, Rabbani MT, Nazari R, Zacks MA, Hayes B, Sierra RG, Hunter MS, Lisova S, Batyuk A, Kupitz C, Boutet S, Hansen DT, Kirian RA, Schmidt M, Fromme R, Frank M, Ros A, Chen JJ, Botha S, Fromme P. Structure. 2022 Dec 30:S0969-2126(22)00495-6. doi: 10.1016/j.str.2022.12.009. 10.1016/j.str.2022.12.009 PubMed 36630960
Related items:
Commonly requested with: