Skip to main content
Addgene

px552-sg-gria1-HT-SEP
(Plasmid #187653)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187653 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    px552-sg-gria1-HT
  • Backbone size w/o insert (bp) 3293
  • Total vector size (bp) 5031
  • Modifications to backbone
    Synapsin promoter and miRFP670 removed
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag-SEP donor
  • Species
    Synthetic
  • Insert Size (bp)
    1736
  • Promoter N/A
  • Tag / Fusion Protein
    • N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggctagtccgttatcaacttg
  • 3′ sequencing primer tcaccaggtgtacatcatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px552-sg-gria1-HT-SEP was a gift from Erin O'Shea (Addgene plasmid # 187653 ; http://n2t.net/addgene:187653 ; RRID:Addgene_187653)
  • For your References section:

    Plasticity-induced actin polymerization in the dendritic shaft regulates intracellular AMPA receptor trafficking. Wong VC, Houlihan PR, Liu H, Walpita D, DeSantis MC, Liu Z, O'Shea EK. eLife. 2024 Aug 15;13:e80622. doi: 10.7554/eLife.80622. 10.7554/eLife.80622 PubMed 39146380