px552-sg-gria1-HT
(Plasmid #187652)

• Purpose: Contains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.
• Depositing Lab: Erin O'Shea
• Publication: Wong et al Elife. 2024 Aug 15;13:e80622. doi: 10.7554/eLife.80622.

Backbone

• Vector backbone: PX552
• Backbone size w/o insert (bp): 5273
• Total vector size (bp): 6276
• Modifications to backbone: EGFP replaced with miRFP670
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: HaloTag donor sequence
• Species: Synthetic
• Insert Size (bp): 1003
• Tag / Fusion Protein:
  • N/A

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggctagtccgttatcaacttg
• 3′ sequencing primer: tgcatttatggagttcatccgc

Gene/Insert 2

• Gene/Insert name: miRFP670
• Species: Synthetic
• Insert Size (bp): 956
• Promoter: Synapsin
• Tag / Fusion Protein:
  • N/A

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tcagcgctgcctcagtctgc
• 3′ sequencing primer: atagaaggacacctagtcag

Resource Information

• Supplemental Documents:
  • px552-sg-gria1-HT.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry