hSyn-tractin
(Plasmid #187649)

• Purpose: Expresses F-tractin (from ITPKA)-mNeongreen under control of human synapsin promoter.
• Depositing Lab: Erin O'Shea
• Publication: Wong et al Elife. 2024 Aug 15;13:e80622. doi: 10.7554/eLife.80622.

Backbone

• Vector backbone: px552-sg-gria1-HT
• Backbone size w/o insert (bp): 3977
• Total vector size (bp): 4820
• Modifications to backbone: U6 promoter and sgRNA removed
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: F-tractin
• Alt name: ITPKA
• Species: Synthetic
• Insert Size (bp): 843
• Promoter: Synapsin
• Tag / Fusion Protein:
  • mNeonGreen (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: tcagcgctgcctcagtctgc
• 3′ sequencing primer: atagaaggacacctagtcag

Resource Information

• Supplemental Documents:
  • hSyn-tractin.gbk
• A portion of this plasmid was derived from a plasmid made by: Addgene #98883

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry