Skip to main content
Addgene

hSyn-GEM
(Plasmid #187648)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187648 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    hSyn-tractin
  • Backbone size w/o insert (bp) 3501
  • Total vector size (bp) 6507
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PfV
  • Alt name
    GEM
  • Species
    Pyrococcus furiosus
  • Insert Size (bp)
    2556
  • Promoter Synapsin
  • Tags / Fusion Proteins
    • HaloTag (C terminal on insert)
    • SNAP-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer tcagcgctgcctcagtctgc
  • 3′ sequencing primer atagaaggacacctagtcag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #116934

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSyn-GEM was a gift from Erin O'Shea (Addgene plasmid # 187648 ; http://n2t.net/addgene:187648 ; RRID:Addgene_187648)
  • For your References section:

    Plasticity-induced actin polymerization in the dendritic shaft regulates intracellular AMPA receptor trafficking. Wong VC, Houlihan PR, Liu H, Walpita D, DeSantis MC, Liu Z, O'Shea EK. Elife. 2024 Aug 15;13:e80622. doi: 10.7554/eLife.80622. 10.7554/eLife.80622 PubMed 39146380