hSyn-GEM
(Plasmid
#187648)
-
PurposeExpresses the rheological probe PfV-HaloTag-SNAP-tag (GEM-HaloTag-SNAP-tag) under control of human synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonehSyn-tractin
- Backbone size w/o insert (bp) 3501
- Total vector size (bp) 6507
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePfV
-
Alt nameGEM
-
SpeciesPyrococcus furiosus
-
Insert Size (bp)2556
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- HaloTag (C terminal on insert)
- SNAP-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer tcagcgctgcctcagtctgc
- 3′ sequencing primer atagaaggacacctagtcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #116934
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSyn-GEM was a gift from Erin O'Shea (Addgene plasmid # 187648 ; http://n2t.net/addgene:187648 ; RRID:Addgene_187648) -
For your References section:
Plasticity-induced actin polymerization in the dendritic shaft regulates intracellular AMPA receptor trafficking. Wong VC, Houlihan PR, Liu H, Walpita D, DeSantis MC, Liu Z, O'Shea EK. Elife. 2024 Aug 15;13:e80622. doi: 10.7554/eLife.80622. 10.7554/eLife.80622 PubMed 39146380