Skip to main content
Addgene

LentiCRISPRv2 RFP670
(Plasmid #187646)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187646 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 13357
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RFP 670
  • Species
    S. pyogenes
  • Insert Size (bp)
    936
  • Promoter EFS (P2A)
  • Tags / Fusion Proteins
    • RFP670
    • sgRNA cloning site

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gattacaaagacgatgacgataag
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2 RFP670 was a gift from Martin Carroll (Addgene plasmid # 187646 ; http://n2t.net/addgene:187646 ; RRID:Addgene_187646)