LentiCRISPRv2 RFP670
(Plasmid
#187646)
-
Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning site
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 13357
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRFP 670
-
SpeciesS. pyogenes
-
Insert Size (bp)936
- Promoter EFS (P2A)
-
Tags
/ Fusion Proteins
- RFP670
- sgRNA cloning site
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gattacaaagacgatgacgataag
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2 RFP670 was a gift from Martin Carroll (Addgene plasmid # 187646 ; http://n2t.net/addgene:187646 ; RRID:Addgene_187646)