pEX128·gRNA
(Plasmid
#187600)
-
PurposeTemplate for amplification of gRNA with Cas6 recognition site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187600 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEX-A128
-
Backbone manufacturerEurofins
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA template
-
Alt namegRNA-csy4
-
gRNA/shRNA sequenceCGACGGCCAGAAGATCGGTT
- Promoter no promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggagcagacaagcccgtcagg
- 3′ sequencing primer caggctttacactttatgcttccggct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySynthesised from Eurofins
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEX128·gRNA was a gift from Pablo Ivan Nikel (Addgene plasmid # 187600 ; http://n2t.net/addgene:187600 ; RRID:Addgene_187600) -
For your References section:
Modular (de)construction of complex bacterial phenotypes by CRISPR/nCas9-assisted, multiplex cytidine base-editing. Volke DC, Martino RA, Kozaeva E, Smania AM, Nikel PI. Nat Commun. 2022 May 31;13(1):3026. doi: 10.1038/s41467-022-30780-z. 10.1038/s41467-022-30780-z PubMed 35641501