Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEX128·gRNA
(Plasmid #187600)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187600 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEX-A128
  • Backbone manufacturer
    Eurofins

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA template
  • Alt name
    gRNA-csy4
  • gRNA/shRNA sequence
    CGACGGCCAGAAGATCGGTT
  • Promoter no promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ggagcagacaagcccgtcagg
  • 3′ sequencing primer caggctttacactttatgcttccggct
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Synthesised from Eurofins

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEX128·gRNA was a gift from Pablo Ivan Nikel (Addgene plasmid # 187600 ; http://n2t.net/addgene:187600 ; RRID:Addgene_187600)
  • For your References section:

    Modular (de)construction of complex bacterial phenotypes by CRISPR/nCas9-assisted, multiplex cytidine base-editing. Volke DC, Martino RA, Kozaeva E, Smania AM, Nikel PI. Nat Commun. 2022 May 31;13(1):3026. doi: 10.1038/s41467-022-30780-z. 10.1038/s41467-022-30780-z PubMed 35641501