-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5 alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namethioredoxin-interacting protein
-
Alt nameTxnip
-
Alt nameVDUP-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1193
-
Entrez GeneTxnip (a.k.a. 1200008J08Rik, Hyplip1, THIF, Tbp-2, VDUP1)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site Sal I (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGT (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-TXNIP was a gift from Clark Distelhorst (Addgene plasmid # 18758 ; http://n2t.net/addgene:18758 ; RRID:Addgene_18758) -
For your References section:
Thioredoxin-interacting protein (txnip) is a glucocorticoid-regulated primary response gene involved in mediating glucocorticoid-induced apoptosis. Wang Z, Rong YP, Malone MH, Davis MC, Zhong F, Distelhorst CW. Oncogene. 2006 Mar 23. 25(13):1903-13. 10.1038/sj.onc.1209218 PubMed 16301999