pEGPN-ACE2
(Plasmid
#187483)
-
PurposeExpression vector - ACE2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187483 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGPN
- Backbone size w/o insert (bp) 7456
- Total vector size (bp) 9915
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2448
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAACTCGAACGCTAGCTGTGCGATCGTTT
- 3′ sequencing primer AGGCCTCGGGATTCCTAGGAACAGCGGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGPN-ACE2 was a gift from Lewis Cantley (Addgene plasmid # 187483 ; http://n2t.net/addgene:187483 ; RRID:Addgene_187483) -
For your References section:
Coagulation factors directly cleave SARS-CoV-2 spike and enhance viral entry. Kastenhuber ER, Mercadante M, Nilsson-Payant B, Johnson JL, Jaimes JA, Muecksch F, Weisblum Y, Bram Y, Chandar V, Whittaker GR, tenOever BR, Schwartz RE, Cantley L. Elife. 2022 Mar 23;11. pii: 77444. doi: 10.7554/eLife.77444. 10.7554/eLife.77444 PubMed 35294338