pAAV_hSyn1_AchLightR
(Plasmid
#187463)
-
PurposeExpresses red acetylcholine indicator AchLightR in neuronal cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV.hSynapsin1
-
Backbone manufacturerViral Vector Facility - University of Zurich
- Backbone size w/o insert (bp) 4444
- Total vector size (bp) 6394
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAchLightR
-
SpeciesSynthetic
-
Insert Size (bp)1950
-
GenBank ID
- Promoter human Synapsin-1
-
Tag
/ Fusion Protein
- Igκ leader (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer caggtttaaggagaccaatagaaactggg
- 3′ sequencing primer aggcattaaagcagcgtatccacatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hSyn1_AchLightR was a gift from Tommaso Patriarchi (Addgene plasmid # 187463 ; http://n2t.net/addgene:187463 ; RRID:Addgene_187463) -
For your References section:
Sensitive multicolor indicators for monitoring norepinephrine in vivo. Kagiampaki Z, Rohner V, Kiss C, Curreli S, Dieter A, Wilhelm M, Harada M, Duss SN, Dernic J, Bhat MA, Zhou X, Ravotto L, Ziebarth T, Wasielewski LM, Sonmez L, Benke D, Weber B, Bohacek J, Reiner A, Wiegert JS, Fellin T, Patriarchi T. Nat Methods. 2023 Sep;20(9):1426-1436. doi: 10.1038/s41592-023-01959-z. 10.1038/s41592-023-01959-z PubMed 37474807