Skip to main content
Addgene

iMAP-61
(Plasmid #187460)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187460 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    unknown
  • Vector type
    Mammalian Expression ; piggyBac

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA array
  • Insert Size (bp)
    13634
  • Promoter modified U6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CATTTCCCCGAAAAGTGCCACCTG
  • 3′ sequencing primer GCTCACATGTTCTTTCCTGCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    iMAP-61 was a gift from Tian Chi (Addgene plasmid # 187460 ; http://n2t.net/addgene:187460 ; RRID:Addgene_187460)

  • For your References section:

    Large-scale multiplexed mosaic CRISPR perturbation in the whole organism. Liu B, Jing Z, Zhang X, Chen Y, Mao S, Kaundal R, Zou Y, Wei G, Zang Y, Wang X, Lin W, Di M, Sun Y, Chen Q, Li Y, Xia J, Sun J, Lin CP, Huang X, Chi T. Cell. 2022 Aug 4;185(16):3008-3024.e16. doi: 10.1016/j.cell.2022.06.039. Epub 2022 Jul 22. 10.1016/j.cell.2022.06.039 PubMed 35870449
Related items:
Commonly requested with: