ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1
(Plasmid #187458)

• Purpose: Coselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 epegRNA (tevopreQ1) with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmid
• Depositing Lab: Yannick Doyon
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pU6-tevopreq1-GG-acceptor
• Backbone size w/o insert (bp): 3041
• Total vector size (bp): 3475
• Vector type: Mammalian Expression, CRISPR ; Prime editing

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G6 T804N epegRNA (tevopreQ1)
• gRNA/shRNA sequence: GCAAACATTCCACTACCACT
• Species: H. sapiens (human)
• Entrez Gene: ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
• Promoter: Tandem U6 promoters

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CAGGGTTATTGTCTCATGAGCGG
• 3′ sequencing primer: GGGAAACGCCTGGTATCTTT

Resource Information

• Supplemental Documents:
  • ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Prime editing vector derived from pU6-tevopreq1-GG-acceptor. See Nelson et al. Nature Biotechnology (2021) for the detailed epegRNA (tevopreq1) cloning protocol to target your gene of interest. False-positive colonies will appear pink or red if the RFP insert has not been replaced by the new epegRNA cassette. The ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreq1 can be used in more challenging settings to generate ouabain-resistant cells.

Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.