Skip to main content
Addgene

ATP1A1_T804N_hPGK1_EBFP_Donor
(Plasmid #187455)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187455 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5382
  • Vector type
    Mammalian Expression
  • Selectable markers
    Ouabain

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1-T804N EBFP donor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1584
  • Entrez Gene
    ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
  • Promoter hPGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TGAGCGAGGAAGCGGAAGAG
  • 3′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be used in combination with pX330_ATP1A1_G7 or eSpCas9(1.1)_No_FLAG_ATP1A1_G7 to target EBFP to ATP1A1 intron 17. A user-specified transgene of interest can also be cloned using restriction cloning sites upstream (KpnI, AflII, NcoI) and downstream (SbfI) of the EBFP gene cassette.

Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP1A1_T804N_hPGK1_EBFP_Donor was a gift from Yannick Doyon (Addgene plasmid # 187455 ; http://n2t.net/addgene:187455 ; RRID:Addgene_187455)

  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338
Related items:
Commonly requested with: