AAV_Syn_Xph18_eGFP_CCR5TC
(Plasmid #187443)

• Purpose: Encodes a specific PSD-95 binder (Xph18) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domain
• Depositing Lab: Matthieu Sainlos
• Publication: Rimbault et al Elife. 2024 Jan 3;13:e69620. doi: 10.7554/eLife.69620.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV2
• Total vector size (bp): 5747
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Xph18
• Species: Synthetic
• Insert Size (bp): 331
• Promoter: Synapsin
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: gatgctagcgccgccaccatggcggg
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A portion of this plasmid was derived from a plasmid made by Xue Han (Addgene plasmid # 125693 ; http://n2t.net/addgene:125693 ; RRID:Addgene_125693).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.04.07.438431 for bioRxiv preprint.