FER +H122D
(Plasmid
#187428)
-
PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac Dual
-
Backbone manufacturerThermo Fisher (Invitrogen)
- Backbone size w/o insert (bp) 5238
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameATP1A1
-
SpeciesXenodon rhabdocephalus
-
Insert Size (bp)3069
-
Mutationchanged histidine at 128 to aspartic acid
-
GenBank IDMT928200
- Promoter PH
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTCCGGATTATTCATACCGTCCCACCATCG
- 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCTAGTACTTCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATP1B1
-
SpeciesXenodon rhabdocephalus
-
Insert Size (bp)915
-
GenBank IDON168935
- Promoter p10
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site PaeI (unknown if destroyed)
- 5′ sequencing primer CGGGTTCCTTCCGGTATTGTCTCCTTC
- 3′ sequencing primer ACGGACCTTTAATTCAACCCAACACAATATA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.11.29.470343v5 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FER +H122D was a gift from Susanne Dobler (Addgene plasmid # 187428 ; http://n2t.net/addgene:187428 ; RRID:Addgene_187428) -
For your References section:
Constraints on the evolution of toxin-resistant Na,K-ATPases have limited dependence on sequence divergence. Mohammadi S, Herrera-Álvarez S, Yang L, del Pilar Rodríguez-Ordoñez M, Zhang K, Storz JF, Dobler S, Crawford AJ, Andolfatto P. bioRxiv 2021.11.29.470343 10.1101/2021.11.29.470343