pAAV-ND4 Right-E1347A-UGI
(Plasmid
#187415)
-
Purposehuman mitochondrial DNA ND4 target TALE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDddA GSVG variant
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgatgtccctgattatgctgggatccgaattcaagatctgcgtaccctgggttacag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ND4 Right-E1347A-UGI was a gift from Jin-Soo Kim (Addgene plasmid # 187415 ; http://n2t.net/addgene:187415 ; RRID:Addgene_187415) -
For your References section:
Base editing in human cells with monomeric DddA-TALE fusion deaminases. Mok YG, Lee JM, Chung E, Lee J, Lim K, Cho SI, Kim JS. Nat Commun. 2022 Jul 12;13(1):4038. doi: 10.1038/s41467-022-31745-y. 10.1038/s41467-022-31745-y PubMed 35821233