Skip to main content
Addgene

pAAV-ND4 Right-E1347A-UGI
(Plasmid #187415)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187415 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DddA GSVG variant
  • Species
    H. sapiens (human)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgatgtccctgattatgctgggatccgaattcaagatctgcgtaccctgggttacag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-ND4 Right-E1347A-UGI was a gift from Jin-Soo Kim (Addgene plasmid # 187415 ; http://n2t.net/addgene:187415 ; RRID:Addgene_187415)
  • For your References section:

    Base editing in human cells with monomeric DddA-TALE fusion deaminases. Mok YG, Lee JM, Chung E, Lee J, Lim K, Cho SI, Kim JS. Nat Commun. 2022 Jul 12;13(1):4038. doi: 10.1038/s41467-022-31745-y. 10.1038/s41467-022-31745-y PubMed 35821233