Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV mouse Dscam
(Plasmid #18737)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18737 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1 (EGFP deleted)
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dscam
  • Alt name
    Down's syndrome cell adhesion molecule
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Dscam (a.k.a. 4932410A21Rik)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV mouse Dscam was a gift from Joshua Sanes (Addgene plasmid # 18737 ; http://n2t.net/addgene:18737 ; RRID:Addgene_18737)
  • For your References section:

    Dscam and Sidekick proteins direct lamina-specific synaptic connections in vertebrate retina. Yamagata M, Sanes JR. Nature. 2008 Jan 24. 451(7177):465-9. 10.1038/nature06469 PubMed 18216854