Cherry-Myo1b
(Plasmid
#187366)
-
PurposeExpresses rat myosin 1b isoform b domain labelled with Cherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmCherry-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4743
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemyosin 1b isoform b
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3324
-
Entrez GeneMyo1b (a.k.a. Myr1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pmcherry C1 GCCCCGTAATGCAGAAGAAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cherry-Myo1b was a gift from Evelyne Coudrier (Addgene plasmid # 187366 ; http://n2t.net/addgene:187366 ; RRID:Addgene_187366) -
For your References section:
Myosin 1b promotes axon formation by regulating actin wave propagation and growth cone dynamics. Iuliano O, Yoshimura A, Prosperi MT, Martin R, Knolker HJ, Coudrier E. J Cell Biol. 2018 Jun 4;217(6):2033-2046. doi: 10.1083/jcb.201703205. Epub 2018 Mar 27. 10.1083/jcb.201703205 PubMed 29588377