Skip to main content
Addgene

Cherry-Myo1b
(Plasmid #187366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187366 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4743
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    myosin 1b isoform b
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3324
  • Entrez Gene
    Myo1b (a.k.a. Myr1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer pmcherry C1 GCCCCGTAATGCAGAAGAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cherry-Myo1b was a gift from Evelyne Coudrier (Addgene plasmid # 187366 ; http://n2t.net/addgene:187366 ; RRID:Addgene_187366)
  • For your References section:

    Myosin 1b promotes axon formation by regulating actin wave propagation and growth cone dynamics. Iuliano O, Yoshimura A, Prosperi MT, Martin R, Knolker HJ, Coudrier E. J Cell Biol. 2018 Jun 4;217(6):2033-2046. doi: 10.1083/jcb.201703205. Epub 2018 Mar 27. 10.1083/jcb.201703205 PubMed 29588377