EGFP-Myo1b-Tail
(Plasmid
#187365)
-
PurposeExpresses rat myosin 1b isoform b Tail domain labelled with EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4713
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemyosin 1b isoform b Tail domain
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)720
-
Entrez GeneMyo1b (a.k.a. Myr1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EGFP-N (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Myo1b-Tail was a gift from Evelyne Coudrier (Addgene plasmid # 187365 ; http://n2t.net/addgene:187365 ; RRID:Addgene_187365) -
For your References section:
Myosin 1b functions as an effector of EphB signaling to control cell repulsion. Prosperi MT, Lepine P, Dingli F, Paul-Gilloteaux P, Martin R, Loew D, Knolker HJ, Coudrier E. J Cell Biol. 2015 Jul 20;210(2):347-61. doi: 10.1083/jcb.201501018. 10.1083/jcb.201501018 PubMed 26195670