Skip to main content
Addgene

EGFP-Myo1b-Tail
(Plasmid #187365)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187365 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4713
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    myosin 1b isoform b Tail domain
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    720
  • Entrez Gene
    Myo1b (a.k.a. Myr1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Myo1b-Tail was a gift from Evelyne Coudrier (Addgene plasmid # 187365 ; http://n2t.net/addgene:187365 ; RRID:Addgene_187365)
  • For your References section:

    Myosin 1b functions as an effector of EphB signaling to control cell repulsion. Prosperi MT, Lepine P, Dingli F, Paul-Gilloteaux P, Martin R, Loew D, Knolker HJ, Coudrier E. J Cell Biol. 2015 Jul 20;210(2):347-61. doi: 10.1083/jcb.201501018. 10.1083/jcb.201501018 PubMed 26195670