Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EGFP-Myo1b motor
(Plasmid #187364)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187364 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4694
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    myosin 1b isoform b motor domain
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2248
  • Entrez Gene
    Myo1b (a.k.a. Myr1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PCR cloning at EcoRI-XbaI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer ATGGCCAAGAAGGAGGTAAAAT and 3' primer CTGATATCGCTTTTGTTGCGCGT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Myo1b motor was a gift from Evelyne Coudrier (Addgene plasmid # 187364 ; http://n2t.net/addgene:187364 ; RRID:Addgene_187364)
  • For your References section:

    Myosin 1b functions as an effector of EphB signaling to control cell repulsion. Prosperi MT, Lepine P, Dingli F, Paul-Gilloteaux P, Martin R, Loew D, Knolker HJ, Coudrier E. J Cell Biol. 2015 Jul 20;210(2):347-61. doi: 10.1083/jcb.201501018. 10.1083/jcb.201501018 PubMed 26195670