pHRSin_hCD3δ-GFP2
(Plasmid
#187355)
-
PurposeLentiviral expression of truncated hCD3 delta-GFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHRSinGFP2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTruncated hCD3 delta, and GFP2
-
SpeciesH. sapiens (human)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TGCTTCTCGCTTCTGTTCG
- 3′ sequencing primer CCACATAGCGTAAAAGGAGC and pEYFP-R ACCAGGATGGGCACCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHRSin_hCD3δ-GFP2 was a gift from Simon Davis (Addgene plasmid # 187355 ; http://n2t.net/addgene:187355 ; RRID:Addgene_187355) -
For your References section:
Structure of a fully assembled tumor-specific T cell receptor ligated by pMHC. Susac L, Vuong MT, Thomas C, von Bulow S, O'Brien-Ball C, Santos AM, Fernandes RA, Hummer G, Tampe R, Davis SJ. Cell. 2022 Aug 18;185(17):3201-3213.e19. doi: 10.1016/j.cell.2022.07.010. 10.1016/j.cell.2022.07.010 PubMed 35985289