pCMV mouse sidekick2
(Plasmid #18735)

• Depositing Lab: Joshua Sanes
• Publication: Yamagata et al Nature. 2008 Jan 24. 451(7177):465-9.

Backbone

• Vector backbone: pEGFP-N1 (EGFP deleted)
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sidekick-2
• Alt name: sidekick 2
• Species: M. musculus (mouse)
• Entrez Gene: Sdk2 (a.k.a. 4632412F08Rik, 5330435L01Rik, Sdk-2, mKIAA1514)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: n/a

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC.