PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
(Plasmid
#187276)
-
PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLL5.0
- Backbone size w/o insert (bp) 7590
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra)
-
gRNA/shRNA sequenceTCGGCGATGCCTCTTTGAATAAATTCAAGAGATTTATTCAAAGAGGCATCGCCATTTTTT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2814
-
MutationdeltaActin binding domain
-
Entrez GeneANLN (a.k.a. FSGS8, Scraps, scra)
- Promoter U6, CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer mU6 Forward Primer,mCherry-F
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid made by Srikanth Budnar
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Rescue with reconstituted -Anillin A740D,E758K.
5' cloning site: SacII (not destroyed), 3' cloning site: Sbf1 (destroyed).
With regard to all the Anillin sequences, I chose to number these residues as per the canonical sequence which is the full-length isoform. We have been using a smaller isoform, that lacks aa 508-544 as compared to the canonical isoform. The article that identified the Rho binding region on Anillin (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4449299/) followed the residue numbers of the canonical isoform to describe the mutations a740D, E758K (ref figure 2 in the article). Therefore, I chose to follow similar nomenclature when I generated the AHPH-DM for Rashmi's NCB paper. To harmonize the nomenclature across constructs, I continued to number the residues in all the GFP/Cherry Anillin constructs as per the canonical sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain was a gift from Alpha Yap (Addgene plasmid # 187276 ; http://n2t.net/addgene:187276 ; RRID:Addgene_187276) -
For your References section:
Anillin Promotes Cell Contractility by Cyclic Resetting of RhoA Residence Kinetics. Budnar S, Husain KB, Gomez GA, Naghibosadat M, Varma A, Verma S, Hamilton NA, Morris RG, Yap AS. Dev Cell. 2019 Jun 17;49(6):894-906.e12. doi: 10.1016/j.devcel.2019.04.031. Epub 2019 May 16. 10.1016/j.devcel.2019.04.031 PubMed 31105010