Skip to main content
Addgene

PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
(Plasmid #187275)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187275 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLL5.0
  • Backbone size w/o insert (bp) 7590
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Anillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra)
  • gRNA/shRNA sequence
    TCGGCGATGCCTCTTTGAATAAATTCAAGAGATTTATTCAAAGAGGCATCGCCATTTTTT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3324
  • Mutation
    deltaMyosin binding domain
  • Entrez Gene
    ANLN (a.k.a. FSGS8, Scraps, scra)
  • Promoter U6, CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer mU6 Forward Primer,mCherry-F
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Rescue with reconstituted -Anillin deltaMyosin binding domain.

5' cloning site: SacII (not destroyed), 3' cloning site: Sbf1 (destroyed).

With regard to all the Anillin sequences, I chose to number these residues as per the canonical sequence which is the full-length isoform. We have been using a smaller isoform, that lacks aa 508-544 as compared to the canonical isoform. The article that identified the Rho binding region on Anillin (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4449299/) followed the residue numbers of the canonical isoform to describe the mutations a740D, E758K (ref figure 2 in the article). Therefore, I chose to follow similar nomenclature when I generated the AHPH-DM for Rashmi's NCB paper. To harmonize the nomenclature across constructs, I continued to number the residues in all the GFP/Cherry Anillin constructs as per the canonical sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain was a gift from Alpha Yap (Addgene plasmid # 187275 ; http://n2t.net/addgene:187275 ; RRID:Addgene_187275)
  • For your References section:

    Anillin Promotes Cell Contractility by Cyclic Resetting of RhoA Residence Kinetics. Budnar S, Husain KB, Gomez GA, Naghibosadat M, Varma A, Verma S, Hamilton NA, Morris RG, Yap AS. Dev Cell. 2019 Jun 17;49(6):894-906.e12. doi: 10.1016/j.devcel.2019.04.031. Epub 2019 May 16. 10.1016/j.devcel.2019.04.031 PubMed 31105010