Skip to main content
Addgene

Thy1-Brainbow-2.1 R
(Plasmid #18727)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18727 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC18+Thy1 promoter
  • Backbone size w/o insert (bp) 9188
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hrGFPII-NLS ; EYFP ; tdimer2 ; M-mCerulean

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI / XhoI (destroyed during cloning)
  • 3′ cloning site HindIII / XhoI (destroyed during cloning)
  • 5′ sequencing primer Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Author's Map is a representative Brainbow 2.1 construct (M= membrane tethered).

Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).

Please see attached PDF for important additional information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1-Brainbow-2.1 R was a gift from Joshua Sanes (Addgene plasmid # 18727 ; http://n2t.net/addgene:18727 ; RRID:Addgene_18727)

  • For your References section:

    Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Livet J, Weissman TA, Kang H, Draft RW, Lu J, Bennis RA, Sanes JR, Lichtman JW. Nature. 2007 Nov 1. 450(7166):56-62. 10.1038/nature06293 PubMed 17972876
Related items:
Commonly requested with: