Thy1-Brainbow-1.0 L
(Plasmid #18725)

• Depositing Lab: Joshua Sanes
• Publication: Livet et al Nature. 2007 Nov 1. 450(7166):56-62.

Backbone

• Vector backbone: pUC18+Thy1 promoter
• Backbone size w/o insert (bp): 9188
• Vector type: Mammalian Expression, Mouse Targeting, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dTomato ; EYFP ; mCerulean

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI / XhoI (destroyed during cloning)
• 3′ cloning site: SspI / XhoI (destroyed during cloning)
• 5′ sequencing primer: Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG)

Resource Information

• Supplemental Documents:
  • Brainbow Plasmids Information
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Author's Map is a representative Brainbow 1.0 construct. The actual fluorescent genes are as indicated in the Gene/insert name.

Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).

Please see attached PDF for important additional information.