-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC18+Thy1 promoter
- Backbone size w/o insert (bp) 9188
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdimer2 ; M-mEYFP ; M-mCerulean
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI / XhoI (destroyed during cloning)
- 3′ cloning site ScaI / XhoI (destroyed during cloning)
- 5′ sequencing primer Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Author's Map is a representative Brainbow 1.0 construct. The actual fluorescent genes are as indicated in the Gene/insert name (M= membrane tethered).
Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).
Please see attached PDF for important additional information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Thy1-Brainbow-1.0 H was a gift from Joshua Sanes (Addgene plasmid # 18724 ; http://n2t.net/addgene:18724 ; RRID:Addgene_18724) -
For your References section:
Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Livet J, Weissman TA, Kang H, Draft RW, Lu J, Bennis RA, Sanes JR, Lichtman JW. Nature. 2007 Nov 1. 450(7166):56-62. 10.1038/nature06293 PubMed 17972876