Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CMV-hCas9-T2A-miRFP670
(Plasmid #187223)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187223 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.3-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6390
  • Total vector size (bp) 10533
  • Modifications to backbone
    Inserted T2A-miRFP670 at 3' terminal of MCS.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4140
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • Inserted T2A-miRFP670 at 3' terminal of MCS. (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGAAGACACCGGGACCGAT
  • 3′ sequencing primer GGATTCTCCTCCACGTCACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    hCas9 was subcloned from Addgene Plasmid #41815 (hCas9 from George Church)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-hCas9-T2A-miRFP670 was a gift from Jennifer Mitchell (Addgene plasmid # 187223 ; http://n2t.net/addgene:187223 ; RRID:Addgene_187223)
  • For your References section:

    Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673