CMV-NFIB-T2A-miRFP670
(Plasmid #187222)

• Purpose: Expresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.
• Depositing Lab: Jennifer Mitchell
• Publication: Abatti et al Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734.

Backbone

• Vector backbone: pcDNA3.3-TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6390
• Total vector size (bp): 7650
• Modifications to backbone: Inserted T2A-miRFP670 at 3' terminal of MCS.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nuclear Factor I B
• Species: H. sapiens (human)
• Insert Size (bp): 1260
• GenBank ID: NM_005596
• Entrez Gene: NFIB (a.k.a. CTF, HMGIC/NFIB, MACID, NF-I/B, NF1-B, NFI-B, NFI-RED, NFIB2, NFIB3)
• Promoter: CMV
• Tag / Fusion Protein:
  • Inserted T2A-miRFP670 at 3' terminal of MCS. (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAGAAGACACCGGGACCGAT
• 3′ sequencing primer: GGATTCTCCTCCACGTCACC

Resource Information

• Supplemental Documents:
  • cmv-nfib-t2a-mirfp670.gbk
• A portion of this plasmid was derived from a plasmid made by: NFIB was subcloned from Addgene Plasmid #172303 (pIVTR(T7A)-NFIB from Patrik Verstreken)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry