Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLS.400
(Plasmid #187201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187201 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJKR-O-mphR
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Retron Eco4 Reverse Transcriptase
  • Alt name
    Retron Ec83 RT
  • Species
    E. coli
  • Insert Size (bp)
    939
  • Promoter mphR

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCAGGCATCAAATTAAGCAG
  • 3′ sequencing primer CCGTTGTGGTCTCCCTGAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A192P mutation in mphR codon optimized does not affect plasmid function.
Please visit https://doi.org/10.1101/2021.08.11.455990 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLS.400 was a gift from Seth Shipman (Addgene plasmid # 187201 ; http://n2t.net/addgene:187201 ; RRID:Addgene_187201)
  • For your References section:

    Recording gene expression order in DNA by CRISPR addition of retron barcodes. Bhattarai-Kline S, Lear SK, Fishman CB, Lopez SC, Lockshin ER, Schubert MG, Nivala J, Church GM, Shipman SL. Nature. 2022 Aug;608(7921):217-225. doi: 10.1038/s41586-022-04994-6. Epub 2022 Jul 27. 10.1038/s41586-022-04994-6 PubMed 35896746