TALED_Left-stuffer-1397N
(Plasmid
#187167)
-
Purposeoriginal vector to make all constructs
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep3s
- Backbone size w/o insert (bp) 3726
- Total vector size (bp) 6330
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLeft-stuffer-1397N
-
Insert Size (bp)2603
- Promoter pCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TALED_Left-stuffer-1397N was a gift from Jin-Soo Kim (Addgene plasmid # 187167 ; http://n2t.net/addgene:187167 ; RRID:Addgene_187167) -
For your References section:
Targeted A-to-G base editing in human mitochondrial DNA with programmable deaminases. Cho SI, Lee S, Mok YG, Lim K, Lee J, Lee JM, Chung E, Kim JS. Cell. 2022 May 12;185(10):1764-1776.e12. doi: 10.1016/j.cell.2022.03.039. Epub 2022 Apr 25. 10.1016/j.cell.2022.03.039 PubMed 35472302