Skip to main content
Addgene

pX601‐MHP1‐ABEmaxC2‐NG‐E53 ogRNA
(Plasmid #187068)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187068 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gp41-ABEmaxC2‐NG
  • Species
    Synthetic
  • Promoter MHP1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer CTGCATGCCCTCCCTGGGGACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX601‐MHP1‐ABEmaxC2‐NG‐E53 ogRNA was a gift from Renzhi Han (Addgene plasmid # 187068 ; http://n2t.net/addgene:187068 ; RRID:Addgene_187068)
  • For your References section:

    Efficient precise in vivo base editing in adult dystrophic mice. Xu L, Zhang C, Li H, Wang P, Gao Y, Mokadam NA, Ma J, Arnold WD, Han R. Nat Commun. 2021 Jun 17;12(1):3719. doi: 10.1038/s41467-021-23996-y. 10.1038/s41467-021-23996-y PubMed 34140489