pCMV_ABEmaxNG‐NGA
(Plasmid
#187055)
-
PurposeABEmax-SpCas9-NGA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABEmaxNG‐NGA
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TACGGTGGGAGGTCTATATAAGCAGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_ABEmaxNG‐NGA was a gift from Renzhi Han (Addgene plasmid # 187055 ; http://n2t.net/addgene:187055 ; RRID:Addgene_187055) -
For your References section:
Efficient precise in vivo base editing in adult dystrophic mice. Xu L, Zhang C, Li H, Wang P, Gao Y, Mokadam NA, Ma J, Arnold WD, Han R. Nat Commun. 2021 Jun 17;12(1):3719. doi: 10.1038/s41467-021-23996-y. 10.1038/s41467-021-23996-y PubMed 34140489