pLenti_CMV_PsCatCh2.0-YFP
(Plasmid
#186978)
-
PurposeExpresses PsCatCh2.0 channelrhodopsin in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFCMV
- Total vector size (bp) 10386
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePsCatCh2.0-YFP
-
Insert Size (bp)1854
- Promoter CMV
-
Tag
/ Fusion Protein
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgcgaccccaaatactcct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.07.527404v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_CMV_PsCatCh2.0-YFP was a gift from Adam Cohen (Addgene plasmid # 186978 ; http://n2t.net/addgene:186978 ; RRID:Addgene_186978) -
For your References section:
Diminishing neuronal acidification by channelrhodopsins with low proton conduction. Hayward RF, Brooks FP 3rd, Yang S, Gao S, Cohen AE. Elife. 2023 Oct 6;12:RP86833. doi: 10.7554/eLife.86833. 10.7554/eLife.86833 PubMed 37801078