Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40
(Plasmid #186969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186969 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPB
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 4846
  • Total vector size (bp) 8782
  • Vector type
    Mammalian Expression ; PiggyBac
  • Selectable markers
    mCherry (fluorescence)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dnmt3a2
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    3975
  • Mutation
    Isoform 2 (residues 220–908)
  • GenBank ID
    NM_007872.4
  • Entrez Gene
    Dnmt3a (a.k.a. MmuIIIA)
  • Promoter CAG
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CAG-SF TTATGGTAATCGTGCGAGAGG
  • 3′ sequencing primer SV40-SF GGTACCAGGTAAGTGTACCCAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Ires2-mCherry was derived from Cilantro2, a gift from B. Ebert (Addgene #74450). SV40 was derived from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins, a gift from M. Elowitz (Addgene #78099). The pPB vector backbone was prepared by restriction digest of pSLQ2817, a gift from S. Qi (Addgene #84239).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40 was a gift from Brian Liau (Addgene plasmid # 186969 ; http://n2t.net/addgene:186969 ; RRID:Addgene_186969)
  • For your References section:

    Base editor scanning charts the DNMT3A activity landscape. Lue NZ, Garcia EM, Ngan KC, Lee C, Doench JG, Liau BB. Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20. 10.1038/s41589-022-01167-4 PubMed 36266353