Arl6ip1-mEmerald
(Plasmid #186965)

• Purpose: Express Arl6ip1 with C-terminus mEmerald
• Depositing Lab: Ke Xu
• Publication: Wang et al Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5345
• Total vector size (bp): 6698
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ARL6IP1
• Alt name: AIP1; ARMER; SPG61; ARL6IP
• Species: H. sapiens (human)
• Insert Size (bp): 609
• GenBank ID: NM_015161.3 NM_001313858.1
• Entrez Gene: ARL6IP1 (a.k.a. AIP1, ARL6IP, ARMER, SPG61)
• Promoter: CMV Promoter
• Tag / Fusion Protein:
  • mEmerald (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Supplemental Documents:
  • pcdna3-1-arl6ip1-memerald.gb
• A portion of this plasmid was derived from a plasmid made by: Myc-DDK-Arl6ip1(OriGene, RC201681)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry