Rtn3c-mEmerald
(Plasmid #186963)

• Purpose: Express Rtn3c with C-terminus mEmerald
• Depositing Lab: Ke Xu
• Publication: Wang et al Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5345
• Total vector size (bp): 6776
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RTN3C
• Alt name: ASYIP, HAP, NSPL2, NSPLII, RTN3-A1
• Species: M. musculus (mouse)
• Insert Size (bp): 711
• GenBank ID:
• Entrez Gene: Rtn3 (a.k.a. RTN3-A1)
• Promoter: CMV Promoter
• Tag / Fusion Protein:
  • mEmerald (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Supplemental Documents:
  • pcdna3-1-rtn3cmouse-memerald.gb
• A portion of this plasmid was derived from a plasmid made by: GFP-Rtn3c(mouse) was gift from Prof. Tom Rapoport

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry