px459-H3f3a KO sgRNA
(Plasmid
#186940)
-
PurposeH3f3a KO in mouse ES cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx459
- Backbone size w/o insert (bp) 9174
- Total vector size (bp) 9194
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH3f3a KO sgRNA
-
gRNA/shRNA sequenceTAGAAATACCTGTAACGATG
-
SpeciesM. musculus (mouse)
-
Entrez GeneH3f3a (a.k.a. EyeLinc14, H3-3a, H3-3b, H3.3A)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459-H3f3a KO sgRNA was a gift from Zhiguo Zhang (Addgene plasmid # 186940 ; http://n2t.net/addgene:186940 ; RRID:Addgene_186940) -
For your References section:
Stable inheritance of H3.3-containing nucleosomes during mitotic cell divisions. Xu X, Duan S, Hua X, Li Z, He R, Zhaang Z. Nat Commun. 2022 May 6;13(1):2514. doi: 10.1038/s41467-022-30298-4. 10.1038/s41467-022-30298-4 PubMed 35523900