Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px459-Mcm2-2A mutation sgRNA
(Plasmid #186936)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186936 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px459
  • Backbone size w/o insert (bp) 9174
  • Total vector size (bp) 9194
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mcm2-2A mutation sgRNA
  • gRNA/shRNA sequence
    CATCGAGCTCCGGAATGGGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mcm2 (a.k.a. AA959861, AW476101, BM28, CDCL1, Mcmd2, mKIAA0030)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer TTTATGGCGAGGCGGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459-Mcm2-2A mutation sgRNA was a gift from Zhiguo Zhang (Addgene plasmid # 186936 ; http://n2t.net/addgene:186936 ; RRID:Addgene_186936)
  • For your References section:

    Stable inheritance of H3.3-containing nucleosomes during mitotic cell divisions. Xu X, Duan S, Hua X, Li Z, He R, Zhaang Z. Nat Commun. 2022 May 6;13(1):2514. doi: 10.1038/s41467-022-30298-4. 10.1038/s41467-022-30298-4 PubMed 35523900