pRRL-mouse STING #2-gRNA-Cas9-Puro
(Plasmid
#186893)
-
PurposegRNA targeting mouse STING (with Cas9 insert)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRL-Cas9-Puro
- Backbone size w/o insert (bp) 11892
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
Alt nameSTING gRNA #2
-
gRNA/shRNA sequenceGCTGGCCACCAGAAAGATGA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneSting1 (a.k.a. 2610307O08Rik, ERIS, MPYS, Mita, STING, STING-beta, Tmem173)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACGGATCTCGACGGTATCGG
- 3′ sequencing primer AACTTGCTATTTCTAGCTCTAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-mouse STING #2-gRNA-Cas9-Puro was a gift from Jonathan Kagan (Addgene plasmid # 186893 ; http://n2t.net/addgene:186893 ; RRID:Addgene_186893) -
For your References section:
Species-specific self-DNA detection mechanisms by mammalian cyclic GMP-AMP synthases. Mosallanejad K, Kennedy SN, Bahleda KM, Slavik KM, Zhou W, Govande AA, Hancks DC, Kranzusch PJ, Kagan JC. Sci Immunol. 2023 Jan 20;8(79):eabp9765. doi: 10.1126/sciimmunol.abp9765. Epub 2023 Jan 20. 10.1126/sciimmunol.abp9765 PubMed 36662885